Extract longest transcript or longest CDS transcript from GTF annotation file or gencode transcripts fasta file.

Related tags

File & Path Utilities GetTransTool
Overview

GetTransTool Package

There are four types of methods to extract longest transcript or longest CDS regeion with longest transcript from transcripts fasta file or GTF file.

  • 1.Extract longest transcript from gencode transcripts fasta file.

  • 2.Extract longest transcript from gtf format annotation file based on gencode/ensembl/ucsc database.

  • 3.Extract longest CDS regeion with longest transcript from gencode database transcripts fasta file.

  • 4.Extract longest CDS regeion with longest transcript from gtf format annotation file based on ensembl/ucsc database.

Install

$ pip install GetTransTool

Usage

1. get longest transcript from gencode transcripts fasta file:

help infomation:

$ GetLongestTransFromGencode -h
usage: GetLongestTransFromGencode --file gencode.vM28.transcripts.fa.gz --outfile longest_trans.fa

Get longest transcripts from gencode transcripts fasta file.

optional arguments:
  -h, --help            show this help message and exit
  -v, --version         show program's version number and exit
  -f transfile, --file transfile
                        input your transcripts file with ".gz" format. (gencode.vM28.transcripts.fa.gz)
  -o longestfile, --outfile longestfile
                        output your longest transcript file. (longest_trans.fa)

Thank your for your support, if you have any questions or suggestions please contact me: [email protected].

usage:

$ GetLongestTransFromGencode --file gencode.vM28.transcripts.fa.gz --outfile longest_trans_gencode.fa
Your job is running, please wait...
Your job is done!
Running with 32.33 seconds!

there will be three files produced including name_changed.fa, longest_transcripts_info.csv, longest_trans_gencode.fa.

name_changed.fa:

>4933401J01Rik_ENSMUSG00000102693.2_ENSMUST00000193812.2_1070
AAGGAAAGAGGATAACACTTGAAATGTAAATAAAGAAAATACCTAATAAAAATAAATAAA
AACATGCTTTCAAAGGAAATAAAAAGTTGGATTCAAAAATTTAACTTTTGCTCATTTGGT
ATAATCAAGGAAAAGACCTTTGCATATAAAATATATTTTGAATAAAATTCAGTGGAAGAA
...

longest_transcripts_info.csv:

this is the longest transcripts exon length information.

fullname,gene_name,translength
snoZ196_ENSMUSG00002074855.1_ENSMUST00020182568.1_35,snoZ196,35
snoZ159_ENSMUSG00002075734.1_ENSMUST00020182611.1_87,snoZ159,87
n-R5s93_ENSMUSG00000119639.1_ENSMUST00000240071.1_119,n-R5s93,119
...

longest_trans_gencode.fa:

this is the filtered longest transcript fasta file.

>4933401J01Rik_ENSMUSG00000102693.2_ENSMUST00000193812.2_1070
AAGGAAAGAGGATAACACTTGAAATGTAAATAAAGAAAATACCTAATAAAAATAAATAAA
AACATGCTTTCAAAGGAAATAAAAAGTTGGATTCAAAAATTTAACTTTTGCTCATTTGGT
ATAATCAAGGAAAAGACCTTTGCATATAAAATATATTTTGAATAAAATTCAGTGGAAGAA
...

2. Extract longest transcript from gtf format annotation file based on gencode/ensembl/ucsc database:

help infomation:

$ GetLongestTransFromGTF -h
usage: GetLongestTransFromGTF --database ensembl --gtffile Homo_sapiens.GRCh38.101.gtf.gz --genome Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz --outfile longest_trans.fa

Extract longest transcript from gtf format annotation file based on gencode/ensembl/ucsc database.

optional arguments:
  -h, --help            show this help message and exit
  -v, --version         show program's version number and exit
  -d databse, --database databse
                        which annotation database you choose. (default="ensembl", ucsc/ensembl/gencode)
  -g gtffile, --gtffile gtffile
                        input your GTF file with ".gz" format.
  -fa genome, --genome genome
                        your genome fasta file matched with your GTF file with ".gz" format. (Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz)
  -o longestfile, --outfile longestfile
                        output your longest transcript file. (longest_trans.fa)

Thank your for your support, if you have any questions or suggestions please contact me: [email protected].

usage:

$ GetLongestTransFromGTF --database ensembl --gtffile Homo_sapiens.GRCh38.103.gtf.gz --genome Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz --outfile longest_trans_ensembl.fa
Your job is running, please wait...
Your job is done! 
Running with 159.51 seconds!

there will be three files produced including longest_transcripts_info.csv, longest_trans.gtf, longest_trans_ensembl.fa.

longest_transcripts_info.csv:

,transcript_length,gene_name
snoZ196_ENSG00000281780_ENST00000625269_snoRNA,89,snoZ196
hsa-mir-423_ENSG00000266919_ENST00000586878_lncRNA,94,hsa-mir-423
hsa-mir-1253_ENSG00000272920_ENST00000609567_lncRNA,105,hsa-mir-1253
...

longest_trans.gtf:

this is the gtf information for the longest transcripts.

1	havana	gene	11869	14409	.	+	.	gene_id "ENSG00000223972"; gene_version "5"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene";
1	havana	transcript	11869	14409	.	+	.	gene_id "ENSG00000223972"; gene_version "5"; transcript_id "ENST00000456328"; transcript_version "2"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; tag "basic"; transcript_support_level "1";
1	havana	exon	11869	12227	.	+	.	gene_id "ENSG00000223972"; gene_version "5"; transcript_id "ENST00000456328"; transcript_version "2"; exon_number "1"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; exon_id "ENSE00002234944"; exon_version "1"; tag "basic"; transcript_support_level "1";
1	havana	exon	12613	12721	.	+	.	gene_id "ENSG00000223972"; gene_version "5"; transcript_id "ENST00000456328"; transcript_version "2"; exon_number "2"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; exon_id "ENSE00003582793"; exon_version "1"; tag "basic"; transcript_support_level "1";
1	havana	exon	13221	14409	.	+	.	gene_id "ENSG00000223972"; gene_version "5"; transcript_id "ENST00000456328"; transcript_version "2"; exon_number "3"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; exon_id "ENSE00002312635"; exon_version "1"; tag "basic"; transcript_support_level "1";
1	havana	gene	14404	29570	.	-	.	gene_id "ENSG00000227232"; gene_version "5"; gene_name "WASH7P"; gene_source "havana"; gene_biotype "unprocessed_pseudogene";

longest_trans_ensembl.fa:

>DDX11L1_ENSG00000223972_ENST00000456328_transcribed_unprocessed_pseudogene
GTTAACTTGCCGTCAGCCTTTTCTTTGACCTCTTCTTTCTGTTCATGTGTATTTGCTGTC
TCTTAGCCCAGACTTCCCGTGTCCTTTCCACCGGGCCTTTGAGAGGTCACAGGGTCTTGA
TGCTGTGGTCTTCATCTGCAGGTGTCTGACTTCCAGCAACTGCTGGCCTGTGCCAGGGTG
...

for ucsc:

$ GetLongestTransFromGTF --database ucsc --gtffile hg19.ncbiRefSeq.gtf.gz --genome hg19.fa.gz --outfile longest_trans_ucsc.fa

3. Extract longest CDS regeion with longest transcript from gencode database transcripts fasta file.

help infomation:

$ GetCDSLongestFromGencode -h
usage: GetCDSLongestFromGencode --file gencode.vM28.pc_transcripts.fa.gz --outfile longest_cds_trans.fa

Extract longest CDS regeion with longest transcript from gencode database transcripts fasta file.

optional arguments:
  -h, --help            show this help message and exit
  -v, --version         show program's version number and exit
  -f transfile, --file transfile
                        input your protein-coding transcripts file with ".gz" format. (gencode.vM28.pc_transcripts.fa.gz)
  -o longestfile, --outfile longestfile
                        output your longest transcript file. (longest_cds_trans.fa)

Thank your for your support, if you have any questions or suggestions please contact me: [email protected].

usage:

$ GetCDSLongestFromGencode --file gencode.vM28.pc_transcripts.fa.gz --outfile longest_cds_trans_gencode.fa
Your job is running, please wait...
Your job is done! 
Running with 17.67 seconds!

there will be four files produced including name_changed.fa, All_transcripts_cds_info.csv, longest_cds_transcripts_info.csv, longest_cds_trans_gencode.fa.

name_changed.fa:

>Xkr4_ENSMUSG00000051951.6_ENSMUST00000070533.5_151_2094_3634
GCGGCGGCGGGCGAGCGGGCGCTGGAGTAGGAGCTGGGGAGCGGCGCGGCCGGGGAAGGA
AGCCAGGGCGAGGCGAGGAGGTGGCGGGAGGAGGAGACAGCAGGGACAGGTGTCAGATAA
AGGAGTGCTCTCCTCCGCTGCCGAGGCATCATGGCCGCTAAGTCAGACGGGAGGCTGAAG
...

All_transcripts_cds_info.csv:

this is the all transcripts cds and exon length information.

fullname,gene_name,translength,cdslength
>mt-Nd6_ENSMUSG00000064368.1_ENSMUST00000082419.1_1_519_519,>mt-Nd6,519,519
>mt-Nd5_ENSMUSG00000064367.1_ENSMUST00000082418.1_1_1824_1824,>mt-Nd5,1824,1824
>mt-Nd4l_ENSMUSG00000065947.1_ENSMUST00000084013.1_1_297_297,>mt-Nd4l,297,297
...

longest_cds_transcripts_info.csv:

fullname,gene_name,translength,cdslength
>mt-Nd6_ENSMUSG00000064368.1_ENSMUST00000082419.1_1_519_519,>mt-Nd6,519,519
>mt-Nd5_ENSMUSG00000064367.1_ENSMUST00000082418.1_1_1824_1824,>mt-Nd5,1824,1824
>mt-Nd4l_ENSMUSG00000065947.1_ENSMUST00000084013.1_1_297_297,>mt-Nd4l,297,297
...

longest_cds_trans_gencode.fa:

>Xkr4_ENSMUSG00000051951.6_ENSMUST00000070533.5_151_2094_3634
GCGGCGGCGGGCGAGCGGGCGCTGGAGTAGGAGCTGGGGAGCGGCGCGGCCGGGGAAGGA
AGCCAGGGCGAGGCGAGGAGGTGGCGGGAGGAGGAGACAGCAGGGACAGGTGTCAGATAA
AGGAGTGCTCTCCTCCGCTGCCGAGGCATCATGGCCGCTAAGTCAGACGGGAGGCTGAAG
...

4. Extract longest CDS regeion with longest transcript from gtf format annotation file based on ensembl/ucsc database.

help infomation:

$ GetCDSLongestFromGTF -h
usage: GetCDSLongestFromGTF --database ensembl --gtffile Homo_sapiens.GRCh38.101.gtf.gz --genome Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz --outfile longest_cds_trans.fa

Extract longest CDS regeion with longest transcript from gtf format annotation file based on ensembl/ucsc database.

optional arguments:
  -h, --help            show this help message and exit
  -v, --version         show program's version number and exit
  -d databse, --database databse
                        which annotation database you choose. (default="ensembl", ucsc/ensembl)
  -g gtffile, --gtffile gtffile
                        input your GTF file with ".gz" format.
  -fa genome, --genome genome
                        your genome fasta file matched with your GTF file with ".gz" format. (Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz)
  -o cdslongestfile, --outfile cdslongestfile
                        output your longest transcript file. (longest_cds_trans.fa)

Thank your for your support, if you have any questions or suggestions please contact me: [email protected].

usage:

$ GetCDSLongestFromGTF  --database ensembl --gtffile Homo_sapiens.GRCh38.103.gtf.gz --genome Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz --outfile longest_cds_trans_ensembl.fa
Your job is running, please wait...
Your job is done! 
Running with 152.38 seconds!

there will be four files produced including CDS_longest_trans.gtf, All_transcripts_cds_info.csv, longest_cds_transcripts_info.csv, longest_cds_trans_ensembl.fa.

CDS_longest_trans.gtf:

1	ensembl_havana	gene	65419	71585	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding";
1	havana	transcript	65419	71585	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	havana	exon	65419	65433	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "1"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; exon_id "ENSE00003812156"; exon_version "1"; tag "basic";
1	havana	exon	65520	65573	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; exon_id "ENSE00003813641"; exon_version "1"; tag "basic";
1	havana	CDS	65565	65573	.	+	0	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; protein_id "ENSP00000493376"; protein_version "2"; tag "basic";
1	havana	start_codon	65565	65567	.	+	0	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	havana	exon	69037	71585	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "3"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; exon_id "ENSE00003813949"; exon_version "1"; tag "basic";
1	havana	CDS	69037	70005	.	+	0	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "3"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; protein_id "ENSP00000493376"; protein_version "2"; tag "basic";
1	havana	stop_codon	70006	70008	.	+	0	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "3"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	havana	five_prime_utr	65419	65433	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	havana	five_prime_utr	65520	65564	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	havana	three_prime_utr	70009	71585	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	ensembl_havana	gene	450740	451678	.	-	.	gene_id "ENSG00000284733"; gene_version "2"; gene_name "OR4F29"; gene_source "ensembl_havana"; gene_biotype "protein_coding";
...

All_transcripts_cds_info.csv:

this is the all transcripts cds and exon length information.

cdslength,ID,translength,utr5length,gene_name
2709,ZZZ3_ENSG00000036549_ENST00000370801,6412,476,ZZZ3
1227,ZZZ3_ENSG00000036549_ENST00000370798,2468,486,ZZZ3
173,ZZZ3_ENSG00000036549_ENST00000433749,603,430,ZZZ3
...

longest_cds_transcripts_info.csv:

cdslength,ID,translength,utr5length,gene_name
2709,ZZZ3_ENSG00000036549_ENST00000370801,6412,476,ZZZ3
8883,ZZEF1_ENSG00000074755_ENST00000381638,11466,135,ZZEF1
1716,ZYX_ENSG00000159840_ENST00000322764,2228,80,ZYX
...

longest_cds_trans_gencode.fa:

>OR4F5_ENSG00000186092_ENST00000641515_61_1038_2618
CCCAGATCTCTTCAGTTTTTATGCCTCATTCTGTGAAAATTGCTGTAGTCTCTTCCAGTT
ATGAAGAAGGTAACTGCAGAGGCTATTTCCTGGAATGAATCAACGAGTGAAACGAATAAC
TCTATGGTGACTGAATTCATTTTTCTGGGTCTCTCTGATTCTCAGGAACTCCAGACCTTC
...

for ucsc:

$ GetCDSLongestFromGTF  --database ucsc --gtffile hg19.ncbiRefSeq.gtf.gz --genome hg19.fa.gz --outfile longest_cds_trans_ensembl.fa

END

Thank your for your support, if you have any questions or suggestions please contact me: [email protected].

You might also like...
Pti-file-format - Reverse engineering the Polyend Tracker instrument file format

pti-file-format Reverse engineering the Polyend Tracker instrument file format.

Jaap Roes 14 Dec 30, 2022
Generates a clean .txt file of contents of a 3 lined csv file

Generates a clean .txt file of contents of a 3 lined csv file. File contents is the .gml file of some function which stores the contents of the csv as a map.

Alex Eckardt 1 Jan 9, 2022
PaddingZip - a tool that you can craft a zip file that contains the padding characters between the file content.
PaddingZip - a tool that you can craft a zip file that contains the padding characters between the file content.

PaddingZip - a tool that you can craft a zip file that contains the padding characters between the file content.

phithon 53 Nov 7, 2022
File-manager - A basic file manager, written in Python

File Manager A basic file manager, written in Python. Installation Install Pytho

Samuel Ko 1 Feb 5, 2022
Two scripts help you to convert csv file to md file by template

Two scripts help you to convert csv file to md file by template. One help you generate multiple md files with different filenames from the first colume of csv file. Another can generate one md file with several blocks.

null 2 Oct 15, 2022
A simple Python code that takes input from a csv file and makes it into a vcf file.

Contacts-Maker A simple Python code that takes input from a csv file and makes it into a vcf file. Imagine a college or a large community where each y

null 1 Feb 13, 2022
Object-oriented file system path manipulation

path (aka path pie, formerly path.py) implements path objects as first-class entities, allowing common operations on files to be invoked on those path

Jason R. Coombs 1k Dec 28, 2022
An object-oriented approach to Python file/directory operations.

Unipath An object-oriented approach to file/directory operations Version: 1.1 Home page: https://github.com/mikeorr/Unipath Docs: https://github.com/m

Mike Orr 506 Dec 29, 2022
File support for asyncio

aiofiles: file support for asyncio aiofiles is an Apache2 licensed library, written in Python, for handling local disk files in asyncio applications.

Tin Tvrtković 2.1k Jan 1, 2023
Owner
laojunjun
路漫漫其修远兮 吾将上下而求索
laojunjun
GitHub
A tool for batch processing large fasta files and accompanying metadata table to upload to repositories via API

Fasta Uploader A tool for batch processing large fasta files and accompanying metadata table to repositories via API The python fasta_uploader.py scri

Centre for Infectious Disease and One Health 1 Dec 9, 2021
Python code snippets for extracting PDB codes from .fasta files

Python_snippets_for_bioinformatics Python code snippets for extracting PDB codes from .fasta files If you have a single .fasta file for all protein se

Sofi-Mukhtar 3 Feb 9, 2022
Search for files under the specified directory. Extract the file name and file path and import them as data.

Search for files under the specified directory. Extract the file name and file path and import them as data. Based on that, search for the file, select it and open it.

G-jon FujiYama 2 Jan 10, 2022
Extract the windows major and minor build numbers from an ISO file, and automatically sort the iso files.

WindowsBuildFromISO Extract the windows major and minor build numbers from an ISO file, and automatically sort the iso files. Features Parse multiple

Podalirius 9 Nov 9, 2022
Dragon Age: Origins toolset to extract/build .erf files, patch language-specific .dlg files, and view the contents of files in the ERF or GFF format

DAOTools This is a set of tools for Dragon Age: Origins modding. It can patch the text lines of .dlg files, extract and build an .erf file, and view t

null 8 Dec 6, 2022
gitfs is a FUSE file system that fully integrates with git - Version controlled file system

gitfs is a FUSE file system that fully integrates with git. You can mount a remote repository's branch locally, and any subsequent changes made to the files will be automatically committed to the remote.

Presslabs 2.3k Jan 8, 2023
A python script to convert an ucompressed Gnucash XML file to a text file for Ledger and hledger.

README 1 gnucash2ledger gnucash2ledger is a Python script based on the Github Gist by nonducor (nonducor/gcash2ledger.py). This Python script will tak

Thomas Freeman 0 Jan 28, 2022
This is a file deletion program that asks you for an extension of a file (.mp3, .pdf, .docx, etc.) to delete all of the files in a dir that have that extension.

FileBulk This is a file deletion program that asks you for an extension of a file (.mp3, .pdf, .docx, etc.) to delete all of the files in a dir that h

Enoc Mena 1 Jun 26, 2022
Python package to read and display segregated file names present in a directory based on type of the file

tpyfilestructure Python package to read and display segregated file names present in a directory based on type of the file. Installation You can insta

Tharun Kumar T 2 Nov 28, 2021
Small-File-Explorer - I coded a small file explorer with several options

Petit explorateur de fichier / Small file explorer Pour la première option (création de répertoire) / For the first option (creation of a directory) e

Xerox 1 Jan 3, 2022